scramble shrna knockdown vectors Search Results


96
Vector Biolabs scramble shrna with gfp adenovirus
(A) Time course and rate of increase in oleate-driven respiratory activity in MGN3–1 cells. Cells were treated with 10 or 100 nM JD5037, 2.5 M of FCCP (positive control) or vehicle in the presence of the fluorescent extracellular O2 consumption reagent. Oxidative respiration was recorded every 90 sec and the slope of the initial linear increase was calculated. Points and bars are means ± SEM from n = 11–15 experiments, as indicated. *P < 0.05 compared to vehicle. (B) Verification of Cnr1 knockdown by rtPCR in cells used in panel C. Cellular uptake of the constructs was verified by fluorescent microscopy (20x magnification) and the degree of knockdown was determined by rt-PCR, *P < 0.05, n = 4. (C) Oleate-driven oxidative activity in MGN3–1 cells with <t>shRNA-mediated</t> knockdown of Cnr1 expression and their mock-transfected controls, n = 3–8 experiments, as indicated, *P < 0.05.
Scramble Shrna With Gfp Adenovirus, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scramble shrna with gfp adenovirus/product/Vector Biolabs
Average 96 stars, based on 1 article reviews
scramble shrna with gfp adenovirus - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology sirnas
(A) Time course and rate of increase in oleate-driven respiratory activity in MGN3–1 cells. Cells were treated with 10 or 100 nM JD5037, 2.5 M of FCCP (positive control) or vehicle in the presence of the fluorescent extracellular O2 consumption reagent. Oxidative respiration was recorded every 90 sec and the slope of the initial linear increase was calculated. Points and bars are means ± SEM from n = 11–15 experiments, as indicated. *P < 0.05 compared to vehicle. (B) Verification of Cnr1 knockdown by rtPCR in cells used in panel C. Cellular uptake of the constructs was verified by fluorescent microscopy (20x magnification) and the degree of knockdown was determined by rt-PCR, *P < 0.05, n = 4. (C) Oleate-driven oxidative activity in MGN3–1 cells with <t>shRNA-mediated</t> knockdown of Cnr1 expression and their mock-transfected controls, n = 3–8 experiments, as indicated, *P < 0.05.
Sirnas, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sirnas/product/Santa Cruz Biotechnology
Average 90 stars, based on 1 article reviews
sirnas - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

95
Santa Cruz Biotechnology scramble sirna
FIGURE 7 | uc002mbe.2 knockdown inhibits the in vivo sensitivity of HCC cells to TSA. (A) A representative image of an isolated tumor from nude mice subcutaneously inoculated with uc002mbe.2 <t>shRNA-transfected</t> Huh7 cells and shGFP-transfected cells after 14 days of TSA treatment. (B) Tumor growth curve. (C) Mean tumor weight. The data are presented as the mean ± SD of 8 nude mice. ∗p < 0.05. (D) Total RNA extracted from isolated tumor tissue was used to evaluate the efficiency of uc002mbe.2 knockdown by quantitative real-time PCR. (E) Total protein was isolated from xenograft tumors and subjected to Western blotting analyses to evaluate the levels <t>of</t> <t>hnRNPA2B1,</t> p-AKT and p21.
Scramble Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scramble sirna/product/Santa Cruz Biotechnology
Average 95 stars, based on 1 article reviews
scramble sirna - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology scramble shrna
FIGURE 7 | uc002mbe.2 knockdown inhibits the in vivo sensitivity of HCC cells to TSA. (A) A representative image of an isolated tumor from nude mice subcutaneously inoculated with uc002mbe.2 <t>shRNA-transfected</t> Huh7 cells and shGFP-transfected cells after 14 days of TSA treatment. (B) Tumor growth curve. (C) Mean tumor weight. The data are presented as the mean ± SD of 8 nude mice. ∗p < 0.05. (D) Total RNA extracted from isolated tumor tissue was used to evaluate the efficiency of uc002mbe.2 knockdown by quantitative real-time PCR. (E) Total protein was isolated from xenograft tumors and subjected to Western blotting analyses to evaluate the levels <t>of</t> <t>hnRNPA2B1,</t> p-AKT and p21.
Scramble Shrna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scramble shrna/product/Santa Cruz Biotechnology
Average 90 stars, based on 1 article reviews
scramble shrna - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology control scrambled shrna lentiviral particles scr
Figure 3: miR-323-5p mediates AMPKα1 deletion-induced iNOS expression in Abcd1-KO mice mixed glial cells. (A) Abcd1-KO mixed glial cells were silenced for scrambled control (Scr) or AMPKα1 as described in section 2. iNOS mRNA expression (B) was induced and miR-323-5p expression decreased (C) in Abcd1-KO mixed glial cells deleted for AMPKα1 using <t>lentiviral</t> particles. Abcd1-KO mixed glial cells deleted or AMPKα1 and co-transfected with miR-323-5p mimic (MIM) or inhibitors (INB) modulated iNOS mRNA (D) and protein (E) levels. Mimic and inhibitor transfected cells were compared with negative control (NGC) transfected cells. Results represent the mean ± SD of triplicates from three different experiments. ***p<0.001.
Control Scrambled Shrna Lentiviral Particles Scr, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/control scrambled shrna lentiviral particles scr/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
control scrambled shrna lentiviral particles scr - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

96
Addgene inc control scramble shrna
Figure 3: miR-323-5p mediates AMPKα1 deletion-induced iNOS expression in Abcd1-KO mice mixed glial cells. (A) Abcd1-KO mixed glial cells were silenced for scrambled control (Scr) or AMPKα1 as described in section 2. iNOS mRNA expression (B) was induced and miR-323-5p expression decreased (C) in Abcd1-KO mixed glial cells deleted for AMPKα1 using <t>lentiviral</t> particles. Abcd1-KO mixed glial cells deleted or AMPKα1 and co-transfected with miR-323-5p mimic (MIM) or inhibitors (INB) modulated iNOS mRNA (D) and protein (E) levels. Mimic and inhibitor transfected cells were compared with negative control (NGC) transfected cells. Results represent the mean ± SD of triplicates from three different experiments. ***p<0.001.
Control Scramble Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/control scramble shrna/product/Addgene inc
Average 96 stars, based on 1 article reviews
control scramble shrna - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

96
Addgene inc shrna control
Figure 3. Depletion <t>of</t> <t>VIRMA</t> impaired the proliferation and invasion of NPC in vivo. A, SUNE-1 cells were stably transduced with scrambled <t>shRNA</t> or sh-VIRMA 1# lentivirus, and quantitative RT-PCR was used for validation. B–E, subcutaneous tumorigenesis model. B, tumor volume of subcutaneous xe- nografts with or without VIRMA depletion was measured every 4 days during 5 weeks of growth. Subcutaneous xenograft tumors were retrieved from sacrificed mice on day 32 after axilla inoculation (C), and the tumor weight was measured (D). E, subcutaneous xenograft tumors were embedded in paraffin and cut into 5 μm sections, which were stained using IHC (VIRMA, upper row) and ISH (E2F7, lower row). Scale bar: 50 μm. F–I, SUNE-1 cells with or without VIRMA silencing were inoculated into the footpad of nude mice to establish the inguinal lymph node metastasis model. F, representative image of primary tumors (footpad) and metastatic inguinal lymph nodes in the inguinal lymph node metastasis model. G, representative images of primary tumor sections stained with hematoxylin and eosin showing tumor cells invasion into lymphatic vessels (arrows). Scale bar: 100 μm. H, representative images of pan- cytokeratin staining in inguinal lymph nodes. Scale bar: 100 μm. I, ratios of inguinal lymph nodes metastasis from primary tumors in the footpad. Data are presented as the mean ± SD. *p < 0.05, **p < 0.01. IHC, immunohistochemistry; ISH, In situ hybridization; NPC, nasopharyngeal carcinoma; VIRMA, vir- like m6A methyltransferase associated.
Shrna Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna control/product/Addgene inc
Average 96 stars, based on 1 article reviews
shrna control - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

95
OriGene scramble control
Figure 3. Depletion <t>of</t> <t>VIRMA</t> impaired the proliferation and invasion of NPC in vivo. A, SUNE-1 cells were stably transduced with scrambled <t>shRNA</t> or sh-VIRMA 1# lentivirus, and quantitative RT-PCR was used for validation. B–E, subcutaneous tumorigenesis model. B, tumor volume of subcutaneous xe- nografts with or without VIRMA depletion was measured every 4 days during 5 weeks of growth. Subcutaneous xenograft tumors were retrieved from sacrificed mice on day 32 after axilla inoculation (C), and the tumor weight was measured (D). E, subcutaneous xenograft tumors were embedded in paraffin and cut into 5 μm sections, which were stained using IHC (VIRMA, upper row) and ISH (E2F7, lower row). Scale bar: 50 μm. F–I, SUNE-1 cells with or without VIRMA silencing were inoculated into the footpad of nude mice to establish the inguinal lymph node metastasis model. F, representative image of primary tumors (footpad) and metastatic inguinal lymph nodes in the inguinal lymph node metastasis model. G, representative images of primary tumor sections stained with hematoxylin and eosin showing tumor cells invasion into lymphatic vessels (arrows). Scale bar: 100 μm. H, representative images of pan- cytokeratin staining in inguinal lymph nodes. Scale bar: 100 μm. I, ratios of inguinal lymph nodes metastasis from primary tumors in the footpad. Data are presented as the mean ± SD. *p < 0.05, **p < 0.01. IHC, immunohistochemistry; ISH, In situ hybridization; NPC, nasopharyngeal carcinoma; VIRMA, vir- like m6A methyltransferase associated.
Scramble Control, supplied by OriGene, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scramble control/product/OriGene
Average 95 stars, based on 1 article reviews
scramble control - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology scrambled control rna oligonucleotides sc-37007
Figure 3. Depletion <t>of</t> <t>VIRMA</t> impaired the proliferation and invasion of NPC in vivo. A, SUNE-1 cells were stably transduced with scrambled <t>shRNA</t> or sh-VIRMA 1# lentivirus, and quantitative RT-PCR was used for validation. B–E, subcutaneous tumorigenesis model. B, tumor volume of subcutaneous xe- nografts with or without VIRMA depletion was measured every 4 days during 5 weeks of growth. Subcutaneous xenograft tumors were retrieved from sacrificed mice on day 32 after axilla inoculation (C), and the tumor weight was measured (D). E, subcutaneous xenograft tumors were embedded in paraffin and cut into 5 μm sections, which were stained using IHC (VIRMA, upper row) and ISH (E2F7, lower row). Scale bar: 50 μm. F–I, SUNE-1 cells with or without VIRMA silencing were inoculated into the footpad of nude mice to establish the inguinal lymph node metastasis model. F, representative image of primary tumors (footpad) and metastatic inguinal lymph nodes in the inguinal lymph node metastasis model. G, representative images of primary tumor sections stained with hematoxylin and eosin showing tumor cells invasion into lymphatic vessels (arrows). Scale bar: 100 μm. H, representative images of pan- cytokeratin staining in inguinal lymph nodes. Scale bar: 100 μm. I, ratios of inguinal lymph nodes metastasis from primary tumors in the footpad. Data are presented as the mean ± SD. *p < 0.05, **p < 0.01. IHC, immunohistochemistry; ISH, In situ hybridization; NPC, nasopharyngeal carcinoma; VIRMA, vir- like m6A methyltransferase associated.
Scrambled Control Rna Oligonucleotides Sc 37007, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scrambled control rna oligonucleotides sc-37007/product/Santa Cruz Biotechnology
Average 90 stars, based on 1 article reviews
scrambled control rna oligonucleotides sc-37007 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology control sirna
Figure 3 | Trimolecular bonds exhibit ‘Dynamic catch’ behaviour. (a) Representative force versus time overlapping plots showing no bond (black), non- stiffening bond (blue) and stiffening bond (red) events. Data (points, grey) were acquired at 1,200 fps and were smoothed using the Savitzky–Golay method. (b,c) Representative force versus time zoom-in plots in the ramping phase showing non-stiffening (b) and stiffening (c) signatures. The force at SP (fsp), the stiffness before SP (ksys 1 ) and after SP (ksys 2 ) are indicated. Zero forces are shown by dotted lines. (d) Mean±s.e.m. (of 450 measurements) stiffness of Thy-1–K562 molecular complexes measured by BFP, from left to right: ka5b1 obtained <t>by</t> <t>Syn4</t> <t>siRNA</t> treatment, kSyn4 obtained by anti-b1 mAb and b1 shRNA treatment, respectively, knon-stiff for all non-stiffening bonds and kws calculated as the /nS weighted sum of ka5b1 and kSyn4. *Po0.05; **Po0.01 as assessed by unpaired, two-tailed Student’s t-test. (e) The relative fraction of Thy-1 bonds: the left column shows trimolecular (empty) versus bimolecular (solid) bond compositions at zero force; the right column shows stiffened (grid) versus non-stiffened (shaded) bond compositions at non-zero force in the ramping phase. (f) Scatter plots of bond lifetimes versus corresponding clamp forces. Individual lifetimes (scatter points) from a were colour- coded for non-stiffening (blue) and stiffening (red) bonds, respectively. (g) Plots of lifetime (mean±s.e.m.) versus force of Thy-1–a5b1 (/ta5b1S, Syn4 siRNA treated, purple square), Thy-1–Syn4 (/tSyn4S, b1 shRNA treated, green triangle) bimolecular bonds and total Thy-1–K562 bonds (/ttotalS, untreated, black circle) for the full force regime investigated. (h) Non-stiffening synergy zoom-in. The low force regime from g (yellow) is highlighted. Weighted sum (by respective /nS in Fig. 2d) of bimolecular bonds (/ta5b1S þ /tSyn4S, blue dashed line) and calculated trimolecular bonds (/ta5b1 þ Syn4S, red dashed line) are shown. (i) Stiffening synergy zoom-in. The high force regime from g (turquoise) is highlighted. Non-stiffening bonds ((/tnon-stiffS þ /tstiffS, green dashed line, /tnon-stiffS, blue square), stiffening bonds (/tstiffS, red triangle) and their weighted sum (by respective /nS in corresponding force regime) are shown in the high force regime.
Control Sirna, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/control sirna/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
control sirna - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

95
Vector Biolabs control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa
Figure 3 | Trimolecular bonds exhibit ‘Dynamic catch’ behaviour. (a) Representative force versus time overlapping plots showing no bond (black), non- stiffening bond (blue) and stiffening bond (red) events. Data (points, grey) were acquired at 1,200 fps and were smoothed using the Savitzky–Golay method. (b,c) Representative force versus time zoom-in plots in the ramping phase showing non-stiffening (b) and stiffening (c) signatures. The force at SP (fsp), the stiffness before SP (ksys 1 ) and after SP (ksys 2 ) are indicated. Zero forces are shown by dotted lines. (d) Mean±s.e.m. (of 450 measurements) stiffness of Thy-1–K562 molecular complexes measured by BFP, from left to right: ka5b1 obtained <t>by</t> <t>Syn4</t> <t>siRNA</t> treatment, kSyn4 obtained by anti-b1 mAb and b1 shRNA treatment, respectively, knon-stiff for all non-stiffening bonds and kws calculated as the /nS weighted sum of ka5b1 and kSyn4. *Po0.05; **Po0.01 as assessed by unpaired, two-tailed Student’s t-test. (e) The relative fraction of Thy-1 bonds: the left column shows trimolecular (empty) versus bimolecular (solid) bond compositions at zero force; the right column shows stiffened (grid) versus non-stiffened (shaded) bond compositions at non-zero force in the ramping phase. (f) Scatter plots of bond lifetimes versus corresponding clamp forces. Individual lifetimes (scatter points) from a were colour- coded for non-stiffening (blue) and stiffening (red) bonds, respectively. (g) Plots of lifetime (mean±s.e.m.) versus force of Thy-1–a5b1 (/ta5b1S, Syn4 siRNA treated, purple square), Thy-1–Syn4 (/tSyn4S, b1 shRNA treated, green triangle) bimolecular bonds and total Thy-1–K562 bonds (/ttotalS, untreated, black circle) for the full force regime investigated. (h) Non-stiffening synergy zoom-in. The low force regime from g (yellow) is highlighted. Weighted sum (by respective /nS in Fig. 2d) of bimolecular bonds (/ta5b1S þ /tSyn4S, blue dashed line) and calculated trimolecular bonds (/ta5b1 þ Syn4S, red dashed line) are shown. (i) Stiffening synergy zoom-in. The high force regime from g (turquoise) is highlighted. Non-stiffening bonds ((/tnon-stiffS þ /tstiffS, green dashed line, /tnon-stiffS, blue square), stiffening bonds (/tstiffS, red triangle) and their weighted sum (by respective /nS in corresponding force regime) are shown in the high force regime.
Control Virus Aav5 Gfp U6 Scrmb Shrna Caacaagatgaagagcaccaa, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa/product/Vector Biolabs
Average 95 stars, based on 1 article reviews
control virus aav5 gfp u6 scrmb shrna caacaagatgaagagcaccaa - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

95
Vector Biolabs shrna sequence
Figure 1 Infusion of virus expressing Nrxn3 <t>shRNA</t> reduced the number of Nrxn3α positive cells. The central amygdala of Long Evans rats was infused <t>with</t> <t>AAV1</t> virus containing the construct AAV1-GFP-mNRXN3-shRNA or a scrambled shRNA. Four weeks after infusion the whisker pad was injected with MeWo cells without varicella zoster virus (no VZV) or MeWo cells containing varicella zoster virus. Six weeks after infusion the brain was isolated and the sections imaged. (A) is a low magnification image of a brain slice indicating green GFP fluorescence from expression of the virus construct in the central amygdala region (white oval). A high magnification image of the GFP positive cells (green) within the central amygdala is shown in (B). Bar = 20 micrometers. (C) shows a histogram for Nrxn3 expression within the central amygdala after infusion of AAV1 and injection of the whisker pad. Each point is from an individual animal. An asterisk indicates a significant difference of α=0.05.
Shrna Sequence, supplied by Vector Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna sequence/product/Vector Biolabs
Average 95 stars, based on 1 article reviews
shrna sequence - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

Image Search Results


(A) Time course and rate of increase in oleate-driven respiratory activity in MGN3–1 cells. Cells were treated with 10 or 100 nM JD5037, 2.5 M of FCCP (positive control) or vehicle in the presence of the fluorescent extracellular O2 consumption reagent. Oxidative respiration was recorded every 90 sec and the slope of the initial linear increase was calculated. Points and bars are means ± SEM from n = 11–15 experiments, as indicated. *P < 0.05 compared to vehicle. (B) Verification of Cnr1 knockdown by rtPCR in cells used in panel C. Cellular uptake of the constructs was verified by fluorescent microscopy (20x magnification) and the degree of knockdown was determined by rt-PCR, *P < 0.05, n = 4. (C) Oleate-driven oxidative activity in MGN3–1 cells with shRNA-mediated knockdown of Cnr1 expression and their mock-transfected controls, n = 3–8 experiments, as indicated, *P < 0.05.

Journal: Cell metabolism

Article Title: Targeting Peripheral CB 1 Receptors Reduces Ethanol Intake via a Gut-Brain Axis

doi: 10.1016/j.cmet.2019.04.012

Figure Lengend Snippet: (A) Time course and rate of increase in oleate-driven respiratory activity in MGN3–1 cells. Cells were treated with 10 or 100 nM JD5037, 2.5 M of FCCP (positive control) or vehicle in the presence of the fluorescent extracellular O2 consumption reagent. Oxidative respiration was recorded every 90 sec and the slope of the initial linear increase was calculated. Points and bars are means ± SEM from n = 11–15 experiments, as indicated. *P < 0.05 compared to vehicle. (B) Verification of Cnr1 knockdown by rtPCR in cells used in panel C. Cellular uptake of the constructs was verified by fluorescent microscopy (20x magnification) and the degree of knockdown was determined by rt-PCR, *P < 0.05, n = 4. (C) Oleate-driven oxidative activity in MGN3–1 cells with shRNA-mediated knockdown of Cnr1 expression and their mock-transfected controls, n = 3–8 experiments, as indicated, *P < 0.05.

Article Snippet: Scramble shRNA with GFP Adenovirus (Ad-scramble-shRNA) , Vector Biolabs , 1122.

Techniques: Activity Assay, Positive Control, Knockdown, Reverse Transcription Polymerase Chain Reaction, Construct, Microscopy, shRNA, Expressing, Transfection

FIGURE 7 | uc002mbe.2 knockdown inhibits the in vivo sensitivity of HCC cells to TSA. (A) A representative image of an isolated tumor from nude mice subcutaneously inoculated with uc002mbe.2 shRNA-transfected Huh7 cells and shGFP-transfected cells after 14 days of TSA treatment. (B) Tumor growth curve. (C) Mean tumor weight. The data are presented as the mean ± SD of 8 nude mice. ∗p < 0.05. (D) Total RNA extracted from isolated tumor tissue was used to evaluate the efficiency of uc002mbe.2 knockdown by quantitative real-time PCR. (E) Total protein was isolated from xenograft tumors and subjected to Western blotting analyses to evaluate the levels of hnRNPA2B1, p-AKT and p21.

Journal: Frontiers in pharmacology

Article Title: LncRNA-uc002mbe.2 Interacting with hnRNPA2B1 Mediates AKT Deactivation and p21 Up-Regulation Induced by Trichostatin in Liver Cancer Cells.

doi: 10.3389/fphar.2017.00669

Figure Lengend Snippet: FIGURE 7 | uc002mbe.2 knockdown inhibits the in vivo sensitivity of HCC cells to TSA. (A) A representative image of an isolated tumor from nude mice subcutaneously inoculated with uc002mbe.2 shRNA-transfected Huh7 cells and shGFP-transfected cells after 14 days of TSA treatment. (B) Tumor growth curve. (C) Mean tumor weight. The data are presented as the mean ± SD of 8 nude mice. ∗p < 0.05. (D) Total RNA extracted from isolated tumor tissue was used to evaluate the efficiency of uc002mbe.2 knockdown by quantitative real-time PCR. (E) Total protein was isolated from xenograft tumors and subjected to Western blotting analyses to evaluate the levels of hnRNPA2B1, p-AKT and p21.

Article Snippet: Scramble siRNA and predesigned siRNA specific for human hnRNPA2B1 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, United States).

Techniques: Knockdown, In Vivo, Isolation, shRNA, Transfection, Real-time Polymerase Chain Reaction, Western Blot

Figure 3: miR-323-5p mediates AMPKα1 deletion-induced iNOS expression in Abcd1-KO mice mixed glial cells. (A) Abcd1-KO mixed glial cells were silenced for scrambled control (Scr) or AMPKα1 as described in section 2. iNOS mRNA expression (B) was induced and miR-323-5p expression decreased (C) in Abcd1-KO mixed glial cells deleted for AMPKα1 using lentiviral particles. Abcd1-KO mixed glial cells deleted or AMPKα1 and co-transfected with miR-323-5p mimic (MIM) or inhibitors (INB) modulated iNOS mRNA (D) and protein (E) levels. Mimic and inhibitor transfected cells were compared with negative control (NGC) transfected cells. Results represent the mean ± SD of triplicates from three different experiments. ***p<0.001.

Journal: Journal of Clinical & Cellular Immunology

Article Title: MicroRNA Regulation of Proinflammatory Response in X-linked Adrenoleukodystrophy

doi: 10.4172/2155-9899.1000349

Figure Lengend Snippet: Figure 3: miR-323-5p mediates AMPKα1 deletion-induced iNOS expression in Abcd1-KO mice mixed glial cells. (A) Abcd1-KO mixed glial cells were silenced for scrambled control (Scr) or AMPKα1 as described in section 2. iNOS mRNA expression (B) was induced and miR-323-5p expression decreased (C) in Abcd1-KO mixed glial cells deleted for AMPKα1 using lentiviral particles. Abcd1-KO mixed glial cells deleted or AMPKα1 and co-transfected with miR-323-5p mimic (MIM) or inhibitors (INB) modulated iNOS mRNA (D) and protein (E) levels. Mimic and inhibitor transfected cells were compared with negative control (NGC) transfected cells. Results represent the mean ± SD of triplicates from three different experiments. ***p<0.001.

Article Snippet: Lentiviral vector mediated knockdown of AMPKα1 in Abcd1-KO mice mixed glial cells Transduction-ready mouse shRNA lentiviral particles (106 TU/ml) for AMPKα1 (consisting of a pool of 3-5 constructs and puromycin selection gene; sc-29674-V) and control scrambled shRNA lentiviral particles (Scr) (106 TU/ml, sc-108080) were purchased from Santa Cruz Biotechnology (Dallas, TX).

Techniques: Expressing, Control, Transfection, Negative Control

Figure 3. Depletion of VIRMA impaired the proliferation and invasion of NPC in vivo. A, SUNE-1 cells were stably transduced with scrambled shRNA or sh-VIRMA 1# lentivirus, and quantitative RT-PCR was used for validation. B–E, subcutaneous tumorigenesis model. B, tumor volume of subcutaneous xe- nografts with or without VIRMA depletion was measured every 4 days during 5 weeks of growth. Subcutaneous xenograft tumors were retrieved from sacrificed mice on day 32 after axilla inoculation (C), and the tumor weight was measured (D). E, subcutaneous xenograft tumors were embedded in paraffin and cut into 5 μm sections, which were stained using IHC (VIRMA, upper row) and ISH (E2F7, lower row). Scale bar: 50 μm. F–I, SUNE-1 cells with or without VIRMA silencing were inoculated into the footpad of nude mice to establish the inguinal lymph node metastasis model. F, representative image of primary tumors (footpad) and metastatic inguinal lymph nodes in the inguinal lymph node metastasis model. G, representative images of primary tumor sections stained with hematoxylin and eosin showing tumor cells invasion into lymphatic vessels (arrows). Scale bar: 100 μm. H, representative images of pan- cytokeratin staining in inguinal lymph nodes. Scale bar: 100 μm. I, ratios of inguinal lymph nodes metastasis from primary tumors in the footpad. Data are presented as the mean ± SD. *p < 0.05, **p < 0.01. IHC, immunohistochemistry; ISH, In situ hybridization; NPC, nasopharyngeal carcinoma; VIRMA, vir- like m6A methyltransferase associated.

Journal: The Journal of biological chemistry

Article Title: VIRMA promotes nasopharyngeal carcinoma, tumorigenesis, and metastasis by upregulation of E2F7 in an m6A-dependent manner.

doi: 10.1016/j.jbc.2023.104677

Figure Lengend Snippet: Figure 3. Depletion of VIRMA impaired the proliferation and invasion of NPC in vivo. A, SUNE-1 cells were stably transduced with scrambled shRNA or sh-VIRMA 1# lentivirus, and quantitative RT-PCR was used for validation. B–E, subcutaneous tumorigenesis model. B, tumor volume of subcutaneous xe- nografts with or without VIRMA depletion was measured every 4 days during 5 weeks of growth. Subcutaneous xenograft tumors were retrieved from sacrificed mice on day 32 after axilla inoculation (C), and the tumor weight was measured (D). E, subcutaneous xenograft tumors were embedded in paraffin and cut into 5 μm sections, which were stained using IHC (VIRMA, upper row) and ISH (E2F7, lower row). Scale bar: 50 μm. F–I, SUNE-1 cells with or without VIRMA silencing were inoculated into the footpad of nude mice to establish the inguinal lymph node metastasis model. F, representative image of primary tumors (footpad) and metastatic inguinal lymph nodes in the inguinal lymph node metastasis model. G, representative images of primary tumor sections stained with hematoxylin and eosin showing tumor cells invasion into lymphatic vessels (arrows). Scale bar: 100 μm. H, representative images of pan- cytokeratin staining in inguinal lymph nodes. Scale bar: 100 μm. I, ratios of inguinal lymph nodes metastasis from primary tumors in the footpad. Data are presented as the mean ± SD. *p < 0.05, **p < 0.01. IHC, immunohistochemistry; ISH, In situ hybridization; NPC, nasopharyngeal carcinoma; VIRMA, vir- like m6A methyltransferase associated.

Article Snippet: For VIRMA stable knockdown, lentiviruses expressing shRNA targeting VIRMA or scrambled shRNA control were co-transfected with lentivirus packaging plasmids pMD2G and psPAX2 (Addgene) into the human embryonic kidney (HEK) 293T cells.

Techniques: In Vivo, Stable Transfection, Transduction, shRNA, Quantitative RT-PCR, Biomarker Discovery, Staining, Immunohistochemistry, In Situ Hybridization

Figure 3 | Trimolecular bonds exhibit ‘Dynamic catch’ behaviour. (a) Representative force versus time overlapping plots showing no bond (black), non- stiffening bond (blue) and stiffening bond (red) events. Data (points, grey) were acquired at 1,200 fps and were smoothed using the Savitzky–Golay method. (b,c) Representative force versus time zoom-in plots in the ramping phase showing non-stiffening (b) and stiffening (c) signatures. The force at SP (fsp), the stiffness before SP (ksys 1 ) and after SP (ksys 2 ) are indicated. Zero forces are shown by dotted lines. (d) Mean±s.e.m. (of 450 measurements) stiffness of Thy-1–K562 molecular complexes measured by BFP, from left to right: ka5b1 obtained by Syn4 siRNA treatment, kSyn4 obtained by anti-b1 mAb and b1 shRNA treatment, respectively, knon-stiff for all non-stiffening bonds and kws calculated as the /nS weighted sum of ka5b1 and kSyn4. *Po0.05; **Po0.01 as assessed by unpaired, two-tailed Student’s t-test. (e) The relative fraction of Thy-1 bonds: the left column shows trimolecular (empty) versus bimolecular (solid) bond compositions at zero force; the right column shows stiffened (grid) versus non-stiffened (shaded) bond compositions at non-zero force in the ramping phase. (f) Scatter plots of bond lifetimes versus corresponding clamp forces. Individual lifetimes (scatter points) from a were colour- coded for non-stiffening (blue) and stiffening (red) bonds, respectively. (g) Plots of lifetime (mean±s.e.m.) versus force of Thy-1–a5b1 (/ta5b1S, Syn4 siRNA treated, purple square), Thy-1–Syn4 (/tSyn4S, b1 shRNA treated, green triangle) bimolecular bonds and total Thy-1–K562 bonds (/ttotalS, untreated, black circle) for the full force regime investigated. (h) Non-stiffening synergy zoom-in. The low force regime from g (yellow) is highlighted. Weighted sum (by respective /nS in Fig. 2d) of bimolecular bonds (/ta5b1S þ /tSyn4S, blue dashed line) and calculated trimolecular bonds (/ta5b1 þ Syn4S, red dashed line) are shown. (i) Stiffening synergy zoom-in. The high force regime from g (turquoise) is highlighted. Non-stiffening bonds ((/tnon-stiffS þ /tstiffS, green dashed line, /tnon-stiffS, blue square), stiffening bonds (/tstiffS, red triangle) and their weighted sum (by respective /nS in corresponding force regime) are shown in the high force regime.

Journal: Nature communications

Article Title: Dynamic catch of a Thy-1-α5β1+syndecan-4 trimolecular complex.

doi: 10.1038/ncomms5886

Figure Lengend Snippet: Figure 3 | Trimolecular bonds exhibit ‘Dynamic catch’ behaviour. (a) Representative force versus time overlapping plots showing no bond (black), non- stiffening bond (blue) and stiffening bond (red) events. Data (points, grey) were acquired at 1,200 fps and were smoothed using the Savitzky–Golay method. (b,c) Representative force versus time zoom-in plots in the ramping phase showing non-stiffening (b) and stiffening (c) signatures. The force at SP (fsp), the stiffness before SP (ksys 1 ) and after SP (ksys 2 ) are indicated. Zero forces are shown by dotted lines. (d) Mean±s.e.m. (of 450 measurements) stiffness of Thy-1–K562 molecular complexes measured by BFP, from left to right: ka5b1 obtained by Syn4 siRNA treatment, kSyn4 obtained by anti-b1 mAb and b1 shRNA treatment, respectively, knon-stiff for all non-stiffening bonds and kws calculated as the /nS weighted sum of ka5b1 and kSyn4. *Po0.05; **Po0.01 as assessed by unpaired, two-tailed Student’s t-test. (e) The relative fraction of Thy-1 bonds: the left column shows trimolecular (empty) versus bimolecular (solid) bond compositions at zero force; the right column shows stiffened (grid) versus non-stiffened (shaded) bond compositions at non-zero force in the ramping phase. (f) Scatter plots of bond lifetimes versus corresponding clamp forces. Individual lifetimes (scatter points) from a were colour- coded for non-stiffening (blue) and stiffening (red) bonds, respectively. (g) Plots of lifetime (mean±s.e.m.) versus force of Thy-1–a5b1 (/ta5b1S, Syn4 siRNA treated, purple square), Thy-1–Syn4 (/tSyn4S, b1 shRNA treated, green triangle) bimolecular bonds and total Thy-1–K562 bonds (/ttotalS, untreated, black circle) for the full force regime investigated. (h) Non-stiffening synergy zoom-in. The low force regime from g (yellow) is highlighted. Weighted sum (by respective /nS in Fig. 2d) of bimolecular bonds (/ta5b1S þ /tSyn4S, blue dashed line) and calculated trimolecular bonds (/ta5b1 þ Syn4S, red dashed line) are shown. (i) Stiffening synergy zoom-in. The high force regime from g (turquoise) is highlighted. Non-stiffening bonds ((/tnon-stiffS þ /tstiffS, green dashed line, /tnon-stiffS, blue square), stiffening bonds (/tstiffS, red triangle) and their weighted sum (by respective /nS in corresponding force regime) are shown in the high force regime.

Article Snippet: For Syn4 siRNA knockdown, human Syn4 siRNA (SC-36588; Santa Cruz Biotechnology) or scrambled control siRNA (SC-37007; Santa Cruz Biotechnology) was transfected into K562 or A375 cells using the Amaxa Nucleofector system (Lonza, Switzerland) at 10 nM, and cells were used the following day for experimentation or verification of knockdown efficiency by flow cytometry.

Techniques: shRNA, Two Tailed Test

Figure 5 | Syn4 engagement is required for dynamic catch and contractility-dependent adhesion maturation. (a) Scatter plot of bond lifetime versus clamp force for HPSE-treated K562 cells. The measurements and colour codes are the same as the data of Fig. 3f, which are overlaid with the same but dimmed colours for comparison. (b) Fraction of non-stiffening (blue) versus stiffening (red) Thy-1–K562 bonds at the absence and presence of anti-b1 mAb, HPSE and those with Syn4 siRNA in K562 cells. The same treatment conditions were used as Fig. 2c. (c) Immunofluorescence images of Pxn, FAK-pY397, overlays (depicting Pxn in green and FAK-pY397 in red), and ratiometric quantification of FAK activation in A375 cells spread on Thy-1 with control (Cont.) or Syn4 siRNA, and with or without 25 mM blebbistatin. Expanded views correspond to the area indicated with a red rectangle. The range of ratio values (in arbitrary values) is indicated by colour scale. Scale bar, 10 mm. (d) Distributions of FAK activation (FAK-pY397:Pxn) versus adhesion size for individual adhesions of representative Cont. (upper) or Syn4 siRNA-treated (lower) cells with or without 25 mM blebbistatin. Statistically significant Pearson’s correlation values and two-tailed P-values are indicated. (e) Mean±s.e.m. for non-treated adhesions binned into groupings o1 mm2, 41 mm2, or non-binned adhesions treated with Bleb. Data sets represent n4800 adhesions from ten cells or greater for each treatment condition. One representative of two independent experiments is shown. *Po0.05; **Po0.01; ***Po0.001; as assessed by unpaired, two-tailed Student’s t-test.

Journal: Nature communications

Article Title: Dynamic catch of a Thy-1-α5β1+syndecan-4 trimolecular complex.

doi: 10.1038/ncomms5886

Figure Lengend Snippet: Figure 5 | Syn4 engagement is required for dynamic catch and contractility-dependent adhesion maturation. (a) Scatter plot of bond lifetime versus clamp force for HPSE-treated K562 cells. The measurements and colour codes are the same as the data of Fig. 3f, which are overlaid with the same but dimmed colours for comparison. (b) Fraction of non-stiffening (blue) versus stiffening (red) Thy-1–K562 bonds at the absence and presence of anti-b1 mAb, HPSE and those with Syn4 siRNA in K562 cells. The same treatment conditions were used as Fig. 2c. (c) Immunofluorescence images of Pxn, FAK-pY397, overlays (depicting Pxn in green and FAK-pY397 in red), and ratiometric quantification of FAK activation in A375 cells spread on Thy-1 with control (Cont.) or Syn4 siRNA, and with or without 25 mM blebbistatin. Expanded views correspond to the area indicated with a red rectangle. The range of ratio values (in arbitrary values) is indicated by colour scale. Scale bar, 10 mm. (d) Distributions of FAK activation (FAK-pY397:Pxn) versus adhesion size for individual adhesions of representative Cont. (upper) or Syn4 siRNA-treated (lower) cells with or without 25 mM blebbistatin. Statistically significant Pearson’s correlation values and two-tailed P-values are indicated. (e) Mean±s.e.m. for non-treated adhesions binned into groupings o1 mm2, 41 mm2, or non-binned adhesions treated with Bleb. Data sets represent n4800 adhesions from ten cells or greater for each treatment condition. One representative of two independent experiments is shown. *Po0.05; **Po0.01; ***Po0.001; as assessed by unpaired, two-tailed Student’s t-test.

Article Snippet: For Syn4 siRNA knockdown, human Syn4 siRNA (SC-36588; Santa Cruz Biotechnology) or scrambled control siRNA (SC-37007; Santa Cruz Biotechnology) was transfected into K562 or A375 cells using the Amaxa Nucleofector system (Lonza, Switzerland) at 10 nM, and cells were used the following day for experimentation or verification of knockdown efficiency by flow cytometry.

Techniques: Comparison, Activation Assay, Control, Two Tailed Test

Figure 1 Infusion of virus expressing Nrxn3 shRNA reduced the number of Nrxn3α positive cells. The central amygdala of Long Evans rats was infused with AAV1 virus containing the construct AAV1-GFP-mNRXN3-shRNA or a scrambled shRNA. Four weeks after infusion the whisker pad was injected with MeWo cells without varicella zoster virus (no VZV) or MeWo cells containing varicella zoster virus. Six weeks after infusion the brain was isolated and the sections imaged. (A) is a low magnification image of a brain slice indicating green GFP fluorescence from expression of the virus construct in the central amygdala region (white oval). A high magnification image of the GFP positive cells (green) within the central amygdala is shown in (B). Bar = 20 micrometers. (C) shows a histogram for Nrxn3 expression within the central amygdala after infusion of AAV1 and injection of the whisker pad. Each point is from an individual animal. An asterisk indicates a significant difference of α=0.05.

Journal: Journal of Pain Research

Article Title: Neurexin 3 Regulates Synaptic Connections Between Central Amygdala Neurons and Excitable Cells of the Lateral Parabrachial Nucleus in Rats with Varicella Zoster Induced Orofacial Pain

doi: 10.2147/jpr.s441706

Figure Lengend Snippet: Figure 1 Infusion of virus expressing Nrxn3 shRNA reduced the number of Nrxn3α positive cells. The central amygdala of Long Evans rats was infused with AAV1 virus containing the construct AAV1-GFP-mNRXN3-shRNA or a scrambled shRNA. Four weeks after infusion the whisker pad was injected with MeWo cells without varicella zoster virus (no VZV) or MeWo cells containing varicella zoster virus. Six weeks after infusion the brain was isolated and the sections imaged. (A) is a low magnification image of a brain slice indicating green GFP fluorescence from expression of the virus construct in the central amygdala region (white oval). A high magnification image of the GFP positive cells (green) within the central amygdala is shown in (B). Bar = 20 micrometers. (C) shows a histogram for Nrxn3 expression within the central amygdala after infusion of AAV1 and injection of the whisker pad. Each point is from an individual animal. An asterisk indicates a significant difference of α=0.05.

Article Snippet: In a separate group of Long Evans rats, the central amygdala was infused with 1 μL of 1 × 1013 TU/mL AAV1 containing a scrambled shRNA sequence (AAV1-GFP-U6-shRNA, Vector Biolabs) mixed 1 to 1 with the synaptophysin construct.

Techniques: Virus, Expressing, shRNA, Construct, Whisker Assay, Injection, Isolation, Slice Preparation, Fluorescence

Figure 3 Synaptophysin was expressed in GABAergic cells of the central amygdala. The central amygdala of Gad1-iCre Long Evans rats was infused with AAV1 containing pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby. During this same surgery the central amygdala was infused with the shRNA viral construct. Image is from a representative rat infused with control shRNA and injected with no VZV. (A) Six weeks after infusion mRuby fluorescent signal (red) was detected within the central amygdala (CeA). White dotted line shows the borders of the central amygdala. Arrow points to the injection site (A and B). Enlarged image of synaptophysin positive cell (red, arrow) within the central amygdala is shown in (C). Hoechst 33342 stain of the nuclei from the same cell (arrow) is shown in blue (D). Bar= 100 µm.

Journal: Journal of Pain Research

Article Title: Neurexin 3 Regulates Synaptic Connections Between Central Amygdala Neurons and Excitable Cells of the Lateral Parabrachial Nucleus in Rats with Varicella Zoster Induced Orofacial Pain

doi: 10.2147/jpr.s441706

Figure Lengend Snippet: Figure 3 Synaptophysin was expressed in GABAergic cells of the central amygdala. The central amygdala of Gad1-iCre Long Evans rats was infused with AAV1 containing pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby. During this same surgery the central amygdala was infused with the shRNA viral construct. Image is from a representative rat infused with control shRNA and injected with no VZV. (A) Six weeks after infusion mRuby fluorescent signal (red) was detected within the central amygdala (CeA). White dotted line shows the borders of the central amygdala. Arrow points to the injection site (A and B). Enlarged image of synaptophysin positive cell (red, arrow) within the central amygdala is shown in (C). Hoechst 33342 stain of the nuclei from the same cell (arrow) is shown in blue (D). Bar= 100 µm.

Article Snippet: In a separate group of Long Evans rats, the central amygdala was infused with 1 μL of 1 × 1013 TU/mL AAV1 containing a scrambled shRNA sequence (AAV1-GFP-U6-shRNA, Vector Biolabs) mixed 1 to 1 with the synaptophysin construct.

Techniques: shRNA, Construct, Control, Injection, Staining

Figure 5 Synaptophysin and CaMKII expression in the lateral parabrachial nucleus. In these rats the central amygdala was infused with virus expressing a scrambled shRNA or a Nrxn3 shRNA. The central amygdala of Gad1-iCre Long Evans rats was infused with AAV1 containing pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby. Excitable cells within the lateral parabrachial nucleus were labeled by infusing this nucleus with AAV5 virus containing pAAV-CaMKIIa-EGFP. After four weeks post-surgery the whisker pad of the infused rats were injected with MeWo cells without varicella zoster virus (no VZV) or MeWo cells containing VZV. Two weeks after injection the brain was isolated and imaged. (A) shows the average number of synaptophysin terminals or puncta localized to each CaMKII positive cell within the lateral parabrachial nucleus. Representative images of rats treated with control shRNA/no VZV (B–E) or control shRNA/VZV (F–I) or Nrxn3 shRNA/no VZV (J–M) or Nrxn3 shRNA/VZV (N–Q) are shown. Hoechst 33342 nuclear stain (B, F, J and N) and CaMKII stain (C, G, K and O) and synaptophysin stain (D, H, L and P) is represented in several cells . Individual CaMKII positive cells (green) are outlined with a white dotted line. Arrows point to synaptophysin positive puncta (red, D, H, L and P) colocalizing with CaMKII staining (E, I, M and Q). Bar = 10 µm. Panel R shows the number of CaMKII positive cells in the lateral parabrachial nucleus that colocalized with synaptophysin. Each point is from an individual animal in panels A and R. An asterisk indicates a significant difference of α=0.05. Representative images of rats treated with control shRNA/no VZV (S) or control shRNA/VZV (T) or Nrxn3 shRNA/no VZV (U) or Nrxn3 shRNA/VZV (V) show cells with synaptophysin stain colocalizing with CaMKII stain (yellow, arrows). Bar = 50 µm.

Journal: Journal of Pain Research

Article Title: Neurexin 3 Regulates Synaptic Connections Between Central Amygdala Neurons and Excitable Cells of the Lateral Parabrachial Nucleus in Rats with Varicella Zoster Induced Orofacial Pain

doi: 10.2147/jpr.s441706

Figure Lengend Snippet: Figure 5 Synaptophysin and CaMKII expression in the lateral parabrachial nucleus. In these rats the central amygdala was infused with virus expressing a scrambled shRNA or a Nrxn3 shRNA. The central amygdala of Gad1-iCre Long Evans rats was infused with AAV1 containing pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby. Excitable cells within the lateral parabrachial nucleus were labeled by infusing this nucleus with AAV5 virus containing pAAV-CaMKIIa-EGFP. After four weeks post-surgery the whisker pad of the infused rats were injected with MeWo cells without varicella zoster virus (no VZV) or MeWo cells containing VZV. Two weeks after injection the brain was isolated and imaged. (A) shows the average number of synaptophysin terminals or puncta localized to each CaMKII positive cell within the lateral parabrachial nucleus. Representative images of rats treated with control shRNA/no VZV (B–E) or control shRNA/VZV (F–I) or Nrxn3 shRNA/no VZV (J–M) or Nrxn3 shRNA/VZV (N–Q) are shown. Hoechst 33342 nuclear stain (B, F, J and N) and CaMKII stain (C, G, K and O) and synaptophysin stain (D, H, L and P) is represented in several cells . Individual CaMKII positive cells (green) are outlined with a white dotted line. Arrows point to synaptophysin positive puncta (red, D, H, L and P) colocalizing with CaMKII staining (E, I, M and Q). Bar = 10 µm. Panel R shows the number of CaMKII positive cells in the lateral parabrachial nucleus that colocalized with synaptophysin. Each point is from an individual animal in panels A and R. An asterisk indicates a significant difference of α=0.05. Representative images of rats treated with control shRNA/no VZV (S) or control shRNA/VZV (T) or Nrxn3 shRNA/no VZV (U) or Nrxn3 shRNA/VZV (V) show cells with synaptophysin stain colocalizing with CaMKII stain (yellow, arrows). Bar = 50 µm.

Article Snippet: In a separate group of Long Evans rats, the central amygdala was infused with 1 μL of 1 × 1013 TU/mL AAV1 containing a scrambled shRNA sequence (AAV1-GFP-U6-shRNA, Vector Biolabs) mixed 1 to 1 with the synaptophysin construct.

Techniques: Expressing, Virus, shRNA, Labeling, Whisker Assay, Injection, Isolation, Control, Staining

Figure 6 Prodynorphin cells within the lateral parabrachial nucleus. The central amygdala of Gad1-iCre Long Evans rats was infused with AAV1 containing pAAV hSyn FLEx mGFP- 2A-Synaptophysin-mRuby. Excitable cells within the lateral parabrachial nucleus were labeled by infusing this nucleus with AAV5 virus containing pAAV-CaMKIIa-EGFP. Four weeks after infusion the whisker pad was injected with either no VZV or VZV. Six weeks after infusion brain sections of the treated rats were immunostained for prodynorphin. In (A and B) multiple prodynorphin positive (red) cells were imaged in the lateral parabrachial nucleus (LPB). Prodynorphin is a marker for neurons involved in pain. Cell nuclei are labeled blue with Hoechst 33342 in (A–C). (B) shows only the prodynorphin cells (red) from the same region and (C) shows only the EGFP positive cells (green). A higher magnification image of the LPB is shown in (D) and cells that colocalize prodynorphin and EGFP are yellow. Insert in (D) is an image through the z plane of the lateral parabrachial nucleus after staining for prodynorphin. Prodynorphin is red, EGFP is green and synaptophysin terminals are in yellow for the insert image in (D). Images are from a representative rat that was treated with Nrxn3 shRNA and VZV. scp = superior cerebellar peduncle. Bar= 20 µm. The histogram in (E) shows the number of EGFP/prodynorphin positive cells that colocalized with synaptophysin in the lateral parabrachial nucleus after knockdown of Nrxn3α in the central amygdala. Each point is from an individual animal. An asterisk indicates a significant difference of α=0.05. Representative images of rats treated with control shRNA/no VZV (F) or control shRNA/VZV (G) or Nrxn3 shRNA/no VZV (H) or Nrxn3 shRNA/VZV (I) show cells with synaptophysin stain colocalizing with prodynorphin stain (yellow, arrows). Bar = 50 µm.

Journal: Journal of Pain Research

Article Title: Neurexin 3 Regulates Synaptic Connections Between Central Amygdala Neurons and Excitable Cells of the Lateral Parabrachial Nucleus in Rats with Varicella Zoster Induced Orofacial Pain

doi: 10.2147/jpr.s441706

Figure Lengend Snippet: Figure 6 Prodynorphin cells within the lateral parabrachial nucleus. The central amygdala of Gad1-iCre Long Evans rats was infused with AAV1 containing pAAV hSyn FLEx mGFP- 2A-Synaptophysin-mRuby. Excitable cells within the lateral parabrachial nucleus were labeled by infusing this nucleus with AAV5 virus containing pAAV-CaMKIIa-EGFP. Four weeks after infusion the whisker pad was injected with either no VZV or VZV. Six weeks after infusion brain sections of the treated rats were immunostained for prodynorphin. In (A and B) multiple prodynorphin positive (red) cells were imaged in the lateral parabrachial nucleus (LPB). Prodynorphin is a marker for neurons involved in pain. Cell nuclei are labeled blue with Hoechst 33342 in (A–C). (B) shows only the prodynorphin cells (red) from the same region and (C) shows only the EGFP positive cells (green). A higher magnification image of the LPB is shown in (D) and cells that colocalize prodynorphin and EGFP are yellow. Insert in (D) is an image through the z plane of the lateral parabrachial nucleus after staining for prodynorphin. Prodynorphin is red, EGFP is green and synaptophysin terminals are in yellow for the insert image in (D). Images are from a representative rat that was treated with Nrxn3 shRNA and VZV. scp = superior cerebellar peduncle. Bar= 20 µm. The histogram in (E) shows the number of EGFP/prodynorphin positive cells that colocalized with synaptophysin in the lateral parabrachial nucleus after knockdown of Nrxn3α in the central amygdala. Each point is from an individual animal. An asterisk indicates a significant difference of α=0.05. Representative images of rats treated with control shRNA/no VZV (F) or control shRNA/VZV (G) or Nrxn3 shRNA/no VZV (H) or Nrxn3 shRNA/VZV (I) show cells with synaptophysin stain colocalizing with prodynorphin stain (yellow, arrows). Bar = 50 µm.

Article Snippet: In a separate group of Long Evans rats, the central amygdala was infused with 1 μL of 1 × 1013 TU/mL AAV1 containing a scrambled shRNA sequence (AAV1-GFP-U6-shRNA, Vector Biolabs) mixed 1 to 1 with the synaptophysin construct.

Techniques: Labeling, Virus, Whisker Assay, Injection, Marker, Staining, shRNA, Knockdown, Control